pCI-TPI_WT-RAB7A_3UTR-xrRNA-4H
(Plasmid
#108372)
-
PurposeExpresses wild type TPI reporter; contains partial RAB7A control 3' UTR; enables detection of 5'-3' decay intermediates (xrFrag) and allows detection via northern blot (4H binding sites)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 108372 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCI-neo
-
Backbone manufacturerPromega
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer GGTGTCCACTCCCAGTTCA
- 3′ sequencing primer TGCATTCTAGTTGTGGTTTGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please see depositor's genbank file in Supplemental Documents for full annotation of the plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCI-TPI_WT-RAB7A_3UTR-xrRNA-4H was a gift from Niels Gehring (Addgene plasmid # 108372 ; http://n2t.net/addgene:108372 ; RRID:Addgene_108372) -
For your References section:
Interrogating the degradation pathways of unstable mRNAs with XRN1-resistant sequences. Boehm V, Gerbracht JV, Marx MC, Gehring NH. Nat Commun. 2016 Dec 5;7:13691. doi: 10.1038/ncomms13691. 10.1038/ncomms13691 PubMed 27917860