Skip to main content
Addgene

pCI-TPI_WT-TNFalpha_3UTR-xrRNA-4H
(Plasmid #108374)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 108374 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCI-neo
  • Backbone manufacturer
    Promega
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Wild type TPI reporter with partial TNFalpha control 3' UTR, MVE xrRNA and 4H probe binding sites
  • Species
    H. sapiens (human)
  • Entrez Gene
    TPI1 (a.k.a. HEL-S-49, TIM, TPI, TPID)
  • Entrez Gene
    TNF (a.k.a. DIF, TNF-alpha, TNFA, TNFSF2, TNLG1F)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer GGTGTCCACTCCCAGTTCA
  • 3′ sequencing primer TGCATTCTAGTTGTGGTTTGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please see depositor's genbank file in Supplemental Documents for full annotation of the plasmid

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCI-TPI_WT-TNFalpha_3UTR-xrRNA-4H was a gift from Niels Gehring (Addgene plasmid # 108374 ; http://n2t.net/addgene:108374 ; RRID:Addgene_108374)
  • For your References section:

    Interrogating the degradation pathways of unstable mRNAs with XRN1-resistant sequences. Boehm V, Gerbracht JV, Marx MC, Gehring NH. Nat Commun. 2016 Dec 5;7:13691. doi: 10.1038/ncomms13691. 10.1038/ncomms13691 PubMed 27917860