-
PurposeBacterial Target-AID vector with sgRNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 108550 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSC101
- Backbone size w/o insert (bp) 9263
- Total vector size (bp) 10639
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 12.5 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Top10
-
Growth instructionsAllow cells to recover for 2 hr in SOC medium. Transformed cells grow slow and colony formation takes 2 days. Do not pick larger colonies as escape cells may appear.
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namedCas9-PmCDA1
-
SpeciesSynthetic; Streptococcus pyogenes
-
Insert Size (bp)7252
-
MutationD10A and H840A for SpCas9
-
GenBank IDOYN72315.1 ABO15149.1
- Promoter lambda OR
-
Tag
/ Fusion Protein
- Flag
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer taaatctatcaccgcaaggg
- 3′ sequencing primer M13F (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameStreptococcus pyogenes sgRNA
-
SpeciesSynthetic
-
Insert Size (bp)138
- Promoter J23119
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ggccctgcaaccattatc
- 3′ sequencing primer gcgtggatccggcttac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pScI_dCas9-CDA_J23119-sgRNA was a gift from Akihiko Kondo (Addgene plasmid # 108550 ; http://n2t.net/addgene:108550 ; RRID:Addgene_108550) -
For your References section:
Deaminase-mediated multiplex genome editing in Escherichia coli. Banno S, Nishida K, Arazoe T, Mitsunobu H, Kondo A. Nat Microbiol. 2018 Feb 5. pii: 10.1038/s41564-017-0102-6. doi: 10.1038/s41564-017-0102-6. 10.1038/s41564-017-0102-6 [pii] PubMed 29403014