Skip to main content

pGEX6P1‐Afu rnhB
(Plasmid #108694)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 108694 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGEX6P1
  • Backbone manufacturer
    Amersham
  • Backbone size w/o insert (bp) 4984
  • Total vector size (bp) 5606
  • Modifications to backbone
    SacI site added between between rnhB stop codon and NotI site
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rnhB
  • Alt name
    RNase HII
  • Species
    Archaeoglobus fulgidus
  • Entrez Gene
    AF_RS03165 (a.k.a. AF_RS03165, AF0621)
  • Promoter tac
  • Tag / Fusion Protein
    • GST (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
  • 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX6P1‐Afu rnhB was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 108694 ; http://n2t.net/addgene:108694 ; RRID:Addgene_108694)
  • For your References section:

    The structure of the human RNase H2 complex defines key interaction interfaces relevant to enzyme function and human disease. Reijns MA, Bubeck D, Gibson LC, Graham SC, Baillie GS, Jones EY, Jackson AP. J Biol Chem. 2011 Mar 25;286(12):10530-9. doi: 10.1074/jbc.M110.177394. Epub 2010 Dec 22. 10.1074/jbc.M110.177394 PubMed 21177854