pGEX6P1‐Afu rnhB
(Plasmid
#108694)
-
PurposeFor expression in E coli, and affinity purification of N-terminally GST-tagged Archaeoglobus fulgidus RNase HII
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 108694 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEX6P1
-
Backbone manufacturerAmersham
- Backbone size w/o insert (bp) 4984
- Total vector size (bp) 5606
-
Modifications to backboneSacI site added between between rnhB stop codon and NotI site
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namernhB
-
Alt nameRNase HII
-
SpeciesArchaeoglobus fulgidus
-
Entrez GeneAF_RS03165 (a.k.a. AF_RS03165, AF0621)
- Promoter tac
-
Tag
/ Fusion Protein
- GST (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX6P1‐Afu rnhB was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 108694 ; http://n2t.net/addgene:108694 ; RRID:Addgene_108694) -
For your References section:
The structure of the human RNase H2 complex defines key interaction interfaces relevant to enzyme function and human disease. Reijns MA, Bubeck D, Gibson LC, Graham SC, Baillie GS, Jones EY, Jackson AP. J Biol Chem. 2011 Mar 25;286(12):10530-9. doi: 10.1074/jbc.M110.177394. Epub 2010 Dec 22. 10.1074/jbc.M110.177394 PubMed 21177854