-
PurposeTet-On construct to induce expression of tandem eGFP-mCherry tagged TOM20MTS (mitochondria
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 109016 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneunknown
-
Backbone manufacturerJacob Corn
- Backbone size w/o insert (bp) 7860
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersmCherry-eGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTOM20MTS (MTS: mitochondria targeting signal)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1608
-
Entrez GeneTOMM20 (a.k.a. MAS20, MOM19, TOM20)
- Promoter CMV promoter
-
Tag
/ Fusion Protein
- mCherry-eGFP (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CTCGTTTAGTGAACCGTCAGATCG
- 3′ sequencing primer CGTGAAGAATGTGCGAGACCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TOM20MTS-mCherry-EGFP-Tet-On was a gift from Jacob Corn (Addgene plasmid # 109016 ; http://n2t.net/addgene:109016 ; RRID:Addgene_109016) -
For your References section:
Atlastins remodel the endoplasmic reticulum for selective autophagy. Liang JR, Lingeman E, Ahmed S, Corn JE. J Cell Biol. 2018 Aug 24. pii: jcb.201804185. doi: 10.1083/jcb.201804185. 10.1083/jcb.201804185 PubMed 30143524