Skip to main content

pLenti-X1-Neo-GFP-ATL2-R244Q
(Plasmid #109023)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 109023 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti-X1-Neo
  • Backbone manufacturer
    Michael Rape
  • Backbone size w/o insert (bp) 9005
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418) ; GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATL2-R244Q
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2493
  • Mutation
    Arg244Gln mutation results in dimerization defect
  • Entrez Gene
    ATL2 (a.k.a. ARL3IP2, ARL6IP2, aip-2, atlastin2)
  • Promoter EIF-1a promoter
  • Tag / Fusion Protein
    • eGFP (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer AGCCTCAGACAGTGGTTCAA
  • 3′ sequencing primer agcagcgtatccacatagcgt
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This ATL2 construct has suspected genomic instability and/or leaky expression that results in bacteria toxicity if grown at 37'C. We recommend bacteria culture at 30'C for 24-36hrs and in large batch for significant yield.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-X1-Neo-GFP-ATL2-R244Q was a gift from Jacob Corn (Addgene plasmid # 109023 ; http://n2t.net/addgene:109023 ; RRID:Addgene_109023)
  • For your References section:

    Atlastins remodel the endoplasmic reticulum for selective autophagy. Liang JR, Lingeman E, Ahmed S, Corn JE. J Cell Biol. 2018 Aug 24. pii: jcb.201804185. doi: 10.1083/jcb.201804185. 10.1083/jcb.201804185 PubMed 30143524