Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pWL1 (mANGPTL8-V5-His)
(Plasmid #109113)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 109113 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Login to view industry pricing.

Backbone

  • Vector backbone
    pcDNA6
  • Backbone size w/o insert (bp) 5058
  • Total vector size (bp) 5652
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ANGPTL8
  • Alt name
    Lipasin
  • Alt name
    RIFL
  • Alt name
    betatrophin
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    594
  • Entrez Gene
    Angptl8 (a.k.a. EG624219, Gm6484, Rifl)
  • Promoter CMV
  • Tags / Fusion Proteins
    • V5 (C terminal on backbone)
    • 6x His (C terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer AGGAAAGGACAGTGGGAGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWL1 (mANGPTL8-V5-His) was a gift from Brandon Davies (Addgene plasmid # 109113 ; http://n2t.net/addgene:109113 ; RRID:Addgene_109113)
  • For your References section:

    ANGPTL8 promotes the ability of ANGPTL3 to bind and inhibit lipoprotein lipase. Chi X, Britt EC, Shows HW, Hjelmaas AJ, Shetty SK, Cushing EM, Li W, Dou A, Zhang R, Davies BSJ. Mol Metab. 2017 Oct;6(10):1137-1149. doi: 10.1016/j.molmet.2017.06.014. Epub 2017 Jun 29. 10.1016/j.molmet.2017.06.014 PubMed 29031715