PtPuc3_diaCas9_sgRNA
(Plasmid #109219)

• Purpose: Episome based vector with CRISPR/Cas9_sgRNA module for genome editing in Phaeodactylum tricornutum
• Depositing Lab: Per Winge
• Publication: Sharma et al Sci Rep. 2018 Sep 26;8(1):14401. doi: 10.1038/s41598-018-32342-0.

Backbone

• Vector backbone: pPtPuc3
• Backbone manufacturer: Addgene Plasmid 62863, Hamilton Smith Lab
• Vector type: CRISPR, Synthetic Biology
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: LHCF2 promoter
• Species: Phaeodactylum tricornutum
• Insert Size (bp): 442
• GenBank ID: Z24761.1
• Promoter: LHCF2 promoter

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: Sac1 (not destroyed)
• 3′ cloning site: Xba1 (not destroyed)
• 5′ sequencing primer: ACACAGGAGTCTGGACTTGAC

Gene/Insert 2

• Gene/Insert name: diaCas9
• Species: Synthetic
• Insert Size (bp): 4283
• Promoter: diaCas9

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xba1 (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TACGACGCTCGCTCCAGCTG
• 3′ sequencing primer: TCCCTGGTTGAGTTCGATAGCA

Gene/Insert 3

• Gene/Insert name: LHCF1 terminator
• Species: Phaeodactylum tricornutum
• Insert Size (bp): 216
• GenBank ID: Z24761.1
• Promoter: LHCF1 terminator

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: Pst1 (not destroyed)
• 5′ sequencing primer: GTTTGTAGAACAGCATAAGCAC

Gene/Insert 4

• Gene/Insert name: U6 promoter
• Species: Phaeodactylum tricornutum
• Insert Size (bp): 280
• GenBank ID: CM000611.1
• Promoter: U6 promoter

Cloning Information for Gene/Insert 4

• Cloning method: Restriction Enzyme
• 5′ cloning site: Pst1 (not destroyed)
• 3′ cloning site: None (unknown if destroyed)
• 5′ sequencing primer: TTTCAGTGAGGACAAGAAGCTC

Gene/Insert 5

• Gene/Insert name: sgRNA
• Species: Synthetic
• Insert Size (bp): 103
• Promoter: sgRNA

Cloning Information for Gene/Insert 5

• Cloning method: Restriction Enzyme
• 5′ cloning site: None (unknown if destroyed)
• 3′ cloning site: None (unknown if destroyed)
• 5′ sequencing primer: CACGCCAAGTATTCATTGTTAG

Gene/Insert 6

• Gene/Insert name: U6 3' region
• Species: Phaeodactylum tricornutum
• Insert Size (bp): 330
• GenBank ID: CM000611.1
• Promoter: U6 3' region

Cloning Information for Gene/Insert 6

• Cloning method: Restriction Enzyme
• 5′ cloning site: None (unknown if destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: CACGCCAAGTATTCATTGTTAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pPtPuc3 episome vector was obtained from Addgene, Plasmid 62863, Hamilton Smith Lab
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry