-
PurposeEpisome based vector with CRISPR/Cas9_sgRNA module for genome editing in Phaeodactylum tricornutum
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 109219 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepPtPuc3
-
Backbone manufacturerAddgene Plasmid 62863, Hamilton Smith Lab
-
Vector typeCRISPR, Synthetic Biology
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameLHCF2 promoter
-
SpeciesPhaeodactylum tricornutum
-
Insert Size (bp)442
-
GenBank IDZ24761.1
- Promoter LHCF2 promoter
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site Sac1 (not destroyed)
- 3′ cloning site Xba1 (not destroyed)
- 5′ sequencing primer ACACAGGAGTCTGGACTTGAC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namediaCas9
-
SpeciesSynthetic
-
Insert Size (bp)4283
- Promoter diaCas9
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site Xba1 (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TACGACGCTCGCTCCAGCTG
- 3′ sequencing primer TCCCTGGTTGAGTTCGATAGCA
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameLHCF1 terminator
-
SpeciesPhaeodactylum tricornutum
-
Insert Size (bp)216
-
GenBank IDZ24761.1
- Promoter LHCF1 terminator
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site Pst1 (not destroyed)
- 5′ sequencing primer GTTTGTAGAACAGCATAAGCAC
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameU6 promoter
-
SpeciesPhaeodactylum tricornutum
-
Insert Size (bp)280
-
GenBank IDCM000611.1
- Promoter U6 promoter
Cloning Information for Gene/Insert 4
- Cloning method Restriction Enzyme
- 5′ cloning site Pst1 (not destroyed)
- 3′ cloning site None (unknown if destroyed)
- 5′ sequencing primer TTTCAGTGAGGACAAGAAGCTC
- (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert namesgRNA
-
SpeciesSynthetic
-
Insert Size (bp)103
- Promoter sgRNA
Cloning Information for Gene/Insert 5
- Cloning method Restriction Enzyme
- 5′ cloning site None (unknown if destroyed)
- 3′ cloning site None (unknown if destroyed)
- 5′ sequencing primer CACGCCAAGTATTCATTGTTAG
- (Common Sequencing Primers)
Gene/Insert 6
-
Gene/Insert nameU6 3' region
-
SpeciesPhaeodactylum tricornutum
-
Insert Size (bp)330
-
GenBank IDCM000611.1
- Promoter U6 3' region
Cloning Information for Gene/Insert 6
- Cloning method Restriction Enzyme
- 5′ cloning site None (unknown if destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CACGCCAAGTATTCATTGTTAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypPtPuc3 episome vector was obtained from Addgene, Plasmid 62863, Hamilton Smith Lab
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PtPuc3_diaCas9_sgRNA was a gift from Per Winge (Addgene plasmid # 109219 ; http://n2t.net/addgene:109219 ; RRID:Addgene_109219) -
For your References section:
Transgene-free genome editing in marine algae by bacterial conjugation - comparison with biolistic CRISPR/Cas9 transformation. Sharma AK, Nymark M, Sparstad T, Bones AM, Winge P. Sci Rep. 2018 Sep 26;8(1):14401. doi: 10.1038/s41598-018-32342-0. 10.1038/s41598-018-32342-0 PubMed 30258061