pU6-crRNA(TBK1)
(Plasmid
#109322)
-
PurposeAAV vector expressing crRNA for AsCpf1 (RR variant) targeting human TBK1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 109322 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneCustom
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemCherry-KASH
-
gRNA/shRNA sequenceGCCAAGATGCAGAGCACTTCTAA (TBK1)
-
SpeciesH. sapiens (human)
-
Entrez GeneTBK1 (a.k.a. FTDALS4, IIAE8, NAK, T2K)
- Promoter hSyn
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGCCTCAGTCTGCGGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-crRNA(TBK1) was a gift from Feng Zhang (Addgene plasmid # 109322 ; http://n2t.net/addgene:109322 ; RRID:Addgene_109322) -
For your References section:
Effects of 3D culturing conditions on the transcriptomic profile of stem-cell-derived neurons. Tekin H, Simmons S, Cummings B, Gao L, Adiconis X, Hession CC, Ghoshal A, Dionne D, Choudhury SR, Yesilyurt V, Sanjana NE, Shi X, Lu C, Heidenreich M, Pan JQ, Levin JZ, Zhang F. Nat Biomed Eng. 2018 Jul;2(7):540-554. doi: 10.1038/s41551-018-0219-9. Epub 2018 Apr 9. 10.1038/s41551-018-0219-9 PubMed 30271673