pcDNA3 SWS cone opsin
(Plasmid
#109363)
-
PurposeHuman SWS cone opsin with 1D4 tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 109363 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5374
- Total vector size (bp) 6449
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSWS cone opsin
-
Alt nameOpn1SWS
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1092
-
GenBank IDNM_001708
-
Entrez GeneOPN1SW (a.k.a. BCP, BOP, CBT)
- Promoter CMV
-
Tag
/ Fusion Protein
- 1D4 (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGAGGTCTATATAAGCAGAGC
- 3′ sequencing primer ggcaccttccagggtcaagg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDNASU plasmid repository, deposited by the Centre for Personalised Diagnostics.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3 SWS cone opsin was a gift from Robert Lucas (Addgene plasmid # 109363 ; http://n2t.net/addgene:109363 ; RRID:Addgene_109363) -
For your References section:
A live cell assay of GPCR coupling allows identification of optogenetic tools for controlling Go and Gi signaling. Ballister ER, Rodgers J, Martial F, Lucas RJ. BMC Biol. 2018 Jan 16;16(1):10. doi: 10.1186/s12915-017-0475-2. 10.1186/s12915-017-0475-2 [pii] PubMed 29338718