Skip to main content

pcDNA3 SWS cone opsin
(Plasmid #109363)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 109363 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5374
  • Total vector size (bp) 6449
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SWS cone opsin
  • Alt name
    Opn1SWS
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1092
  • GenBank ID
    NM_001708
  • Entrez Gene
    OPN1SW (a.k.a. BCP, BOP, CBT)
  • Promoter CMV
  • Tag / Fusion Protein
    • 1D4 (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGAGGTCTATATAAGCAGAGC
  • 3′ sequencing primer ggcaccttccagggtcaagg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    DNASU plasmid repository, deposited by the Centre for Personalised Diagnostics.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3 SWS cone opsin was a gift from Robert Lucas (Addgene plasmid # 109363 ; http://n2t.net/addgene:109363 ; RRID:Addgene_109363)
  • For your References section:

    A live cell assay of GPCR coupling allows identification of optogenetic tools for controlling Go and Gi signaling. Ballister ER, Rodgers J, Martial F, Lucas RJ. BMC Biol. 2018 Jan 16;16(1):10. doi: 10.1186/s12915-017-0475-2. 10.1186/s12915-017-0475-2 [pii] PubMed 29338718