pET24a-VHH-2xTS
(Plasmid
#109419)
-
PurposeBacterial expression of a functionalized anti-GFP (VHH) nanobody fused to two tyrosine sulfation (TS) motifs. VHH-2xTS also contains a T7, HA, BAP and His6 epitope
-
Depositing Lab
-
Sequence Information
-
Sequences (2) — Accept Affinity Reagent Sequence Policy
-
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 109419 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET24a
-
Backbone manufacturerMerck - Novagen
- Total vector size (bp) 5771
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameanti-GFP nanobody fused to a T7, TS, HA, BAP and His6 epitope
-
Alt nameVHHGFP4
-
Alt nametyrosine sulfation sequence
-
SpeciesR. norvegicus (rat), Synthetic
-
Insert Size (bp)588
- Promoter T7
-
Tags
/ Fusion Proteins
- T7 (N terminal on insert)
- HA (C terminal on insert)
- BAP (C terminal on insert)
- His6 (C terminal on insert)
- Tyrosine sulfation (TS) sequence from rat proCCK (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TGCTAGTTATTGCTCAGCGG- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET24a-VHH-2xTS was a gift from Martin Spiess (Addgene plasmid # 109419 ; http://n2t.net/addgene:109419 ; RRID:Addgene_109419) -
For your References section:
A versatile nanobody-based toolkit to analyze retrograde transport from the cell surface. Buser DP, Schleicher KD, Prescianotto-Baschong C, Spiess M. Proc Natl Acad Sci U S A. 2018 Jul 3;115(27):E6227-E6236. doi: 10.1073/pnas.1801865115. Epub 2018 Jun 18. 10.1073/pnas.1801865115 PubMed 29915061