A3Bi-ctd-Cas9n-UGI-NLS
(Plasmid
#109426)
-
PurposeExpresses the C-terminal catalytic domain of human APOBEC3B containing an L1 intron fused to Cas9n, Uracil DNA Glycosylase Inhibitor, with a nuclear localization signal.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 109426 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneBE3
-
Backbone manufacturerDavid Liu
- Backbone size w/o insert (bp) 7825
- Total vector size (bp) 9294
-
Modifications to backboneRemoved rat APOBEC1 and replaced it with the catalytically-active C-terminal domain of human APOBEC3B
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B C-terminal domain
-
Alt nameAPOBEC3B C-terminal Domain
-
Alt nameA3Bctd
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1469
-
MutationInsertion of an L1 intron into the coding sequence of A3B to prevent mutation in E. coli, only cloned the catalytically-active C-terminal domain
-
Entrez GeneAPOBEC3B (a.k.a. A3B, APOBEC1L, ARCD3, ARP4, DJ742C19.2, PHRBNL, bK150C2.2)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site XmaI (not destroyed)
- 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
- 3′ sequencing primer CAAAGAAGGAACCAGGTCCA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
A3Bi-ctd-Cas9n-UGI-NLS was a gift from Reuben Harris (Addgene plasmid # 109426 ; http://n2t.net/addgene:109426 ; RRID:Addgene_109426) -
For your References section:
A fluorescent reporter for quantification and enrichment of DNA editing by APOBEC-Cas9 or cleavage by Cas9 in living cells. St Martin A, Salamango D, Serebrenik A, Shaban N, Brown WL, Donati F, Munagala U, Conticello SG, Harris RS. Nucleic Acids Res. 2018 May 9. pii: 4994269. doi: 10.1093/nar/gky332. 10.1093/nar/gky332 PubMed 29746667