pCC324
(Plasmid
#110165)
-
PurposeminiMos vector expresses ERKKTR-mClover and mCherry-H2B in C. elegans VPCs; request with plasmids pCC335 and pCC336 for unphosphorylated and phosphomimetic controls (Contains Neomycin resistance)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110165 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCFJ910
-
Backbone manufacturerAddgene Plasmid #44481
- Backbone size w/o insert (bp) 5496
- Total vector size (bp) 15703
-
Vector typeWorm Expression ; miniMos transposon
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameERK-KTR-mClover-T2A-mCherry-H2B
-
Alt nameERK-nKTR
-
Alt nameERK-KTR-mClover
-
Alt namemCherry-H2B
-
SpeciesH. sapiens (human), C. elegans (nematode), Synthetic
-
Insert Size (bp)2253
-
MutationR61K change made in ERK-KTR CDS
- Promoter lin-31 promoter/enhancer
-
Tags
/ Fusion Proteins
- mClover (C terminal on insert)
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer caggaaacagctatgaccatg
- 3′ sequencing primer tgtaaaacgacggccagt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byERK-KTR-mClover coding sequence was derived from pENTR-ERKKTRClover, Addgene Plasmid #59138.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCC324 was a gift from Iva Greenwald (Addgene plasmid # 110165 ; http://n2t.net/addgene:110165 ; RRID:Addgene_110165) -
For your References section:
A Real-Time Biosensor for ERK Activity Reveals Signaling Dynamics during C. elegans Cell Fate Specification. de la Cova C, Townley R, Regot S, Greenwald I. Dev Cell. 2017 Sep 11;42(5):542-553.e4. doi: 10.1016/j.devcel.2017.07.014. Epub 2017 Aug 17. 10.1016/j.devcel.2017.07.014 PubMed 28826819