Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

p323-L10A-PATagRFP
(Plasmid #74172)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 74172 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    p323
  • Backbone size w/o insert (bp) 8000
  • Total vector size (bp) 9263
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ribosomal protein L10A
  • Alt name
    rpL10A
  • Alt name
    L10A
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    651
  • Entrez Gene
    Rpl10a
  • Promoter UbC
  • Tag / Fusion Protein
    • PATagRFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TGTACCTATCTTCTTAAGTA
  • 3′ sequencing primer CAT AAA GAG ACA GCA ACC AG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p323-L10A-PATagRFP was a gift from Robert Singer (Addgene plasmid # 74172 ; http://n2t.net/addgene:74172 ; RRID:Addgene_74172)
  • For your References section:

    Mapping translation 'hot-spots' in live cells by tracking single molecules of mRNA and ribosomes. Katz ZB, English BP, Lionnet T, Yoon YJ, Monnier N, Ovryn B, Bathe M, Singer RH. Elife. 2016 Jan 13;5. pii: e10415. doi: 10.7554/eLife.10415. 10.7554/eLife.10415 PubMed 26760529