pCR-II-TOPO-mitfa_LexPR-2A-Cerulean-SV40pA-FRT-Kan-FRT: Sequences,
(Plasmid
#110201)
-
PurposeMelanocyte-specific expression of the LexPR-2A-Cerulean fusion
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110201 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCR-II-TOPO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4000
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsKanamycin is used to verify recombination into an acceptor BAC
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLexPR transactivator - 2A - Cerulean
-
Alt nameLexPR-Cerulean
-
SpeciesSynthetic
-
Insert Size (bp)4798
-
Tag
/ Fusion Protein
- Cerulean (C terminal on insert)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer ATTTAGGTGACACTATAG
- 3′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCR-II-TOPO-mitfa_LexPR-2A-Cerulean-SV40pA-FRT-Kan-FRT: Sequences, was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 110201 ; http://n2t.net/addgene:110201 ; RRID:Addgene_110201) -
For your References section:
Generation of a double binary transgenic zebrafish model to study myeloid gene regulation in response to oncogene activation in melanocytes. Kenyon A, Gavriouchkina D, Zorman J, Chong-Morrison V, Napolitani G, Cerundolo V, Sauka-Spengler T. Dis Model Mech. 2018 Apr 6;11(4). pii: dmm.030056. doi: 10.1242/dmm.030056. 10.1242/dmm.030056 PubMed 29666124