Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLKO.1-TRC.mKO2_shHRASLS.1
(Plasmid #110323)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 110323 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLKO.1-TRC.mKO2
  • Backbone manufacturer
    #85208
  • Backbone size w/o insert (bp) 7032
  • Total vector size (bp) 7102
  • Vector type
    Mammalian Expression, Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HRASLS
  • Alt name
    HRAS like suppressor
  • gRNA/shRNA sequence
    GATAAGTACCGTTGAGTTTG
  • Species
    H. sapiens (human); Homo sapiens
  • GenBank ID
    57110
  • Entrez Gene
    PLAAT1 (a.k.a. A-C1, H-REV107, HRASLS, HRASLS1, HRSL1, HSD28, PLA/AT1, PLAAT-1)
  • Promoter U6 (RNA Pol III)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

See Addgene's pLKO family protocol http://www.addgene.org/plko on how to use the pLKO family vectors.

Plasmid grows more slowly than standard plasmids.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-TRC.mKO2_shHRASLS.1 was a gift from Sandra Martha Gomes Dias (Addgene plasmid # 110323 ; http://n2t.net/addgene:110323 ; RRID:Addgene_110323)
  • For your References section:

    Guanylate-binding protein-1 is a potential new therapeutic target for triple-negative breast cancer. Quintero M, Adamoski D, Reis LMD, Ascencao CFR, Oliveira KRS, Goncalves KA, Dias MM, Carazzolle MF, Dias SMG. BMC Cancer. 2017 Nov 7;17(1):727. doi: 10.1186/s12885-017-3726-2. 10.1186/s12885-017-3726-2 [pii] PubMed 29115931