Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Guanylate-binding protein-1 is a potential new therapeutic target for triple-negative breast cancer.
Quintero M, Adamoski D, Reis LMD, Ascencao CFR, Oliveira KRS, Goncalves KA, Dias MM, Carazzolle MF, Dias SMG
BMC Cancer. 2017 Nov 7;17(1):727. doi: 10.1186/s12885-017-3726-2.
PubMed

Plasmids from Article

ID Plasmid Purpose  
85208pLKO.1-TRC.mKO2Backbone for lentiviral gene silencing with monomeric Kusabira-Orange2 expression
Loading...
85209pLKO.1-shGBP1.1.mKO2TRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.
Loading...
85210pLKO.1-shGBP1.2.mKO2TRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.
Loading...
85224pLKO.1-shLuc.mKO2shLuc (Target TTACGCTGAGTACTTCGA) for silencing luciferase gene as a control and express monomeric Kusabira-Orange2.
Loading...
110318pLKO.1-TRC.mKO2_shGFPControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2
Loading...
110319pLKO.1-TRC.mKO2_shGLSshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2
Loading...
110320pLKO.1-TRC.mKO2_shARL4C.1TRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2
Loading...
110323pLKO.1-TRC.mKO2_shHRASLS.1TRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2
Loading...
110324pLKO.1-TRC.mKO2_shHRASLS.2TRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2
Loading...
110325pLKO.1-TRC.mKO2_shB3GNT5.1TRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2
Loading...

Antibodies from Article