pLKO.1-TRC.mKO2_shHRASLS.2
(Plasmid
#110324)
-
PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110324 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.1-TRC.mKO2
-
Backbone manufacturer#85208
- Backbone size w/o insert (bp) 7032
- Total vector size (bp) 7102
-
Vector typeMammalian Expression, Lentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHRASLS
-
Alt nameHRAS like suppressor
-
gRNA/shRNA sequenceGCGATAAGTACCGTTGAGTTT
-
SpeciesH. sapiens (human); Homo sapiens
-
GenBank ID57110
-
Entrez GenePLAAT1 (a.k.a. A-C1, H-REV107, HRASLS, HRASLS1, HRSL1, HSD28, PLA/AT1, PLAAT-1)
- Promoter U6 (RNA Pol III)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
See Addgene's pLKO family protocol http://www.addgene.org/plko on how to use the pLKO family vectors.
Plasmid grows more slowly than standard plasmids.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-TRC.mKO2_shHRASLS.2 was a gift from Sandra Martha Gomes Dias (Addgene plasmid # 110324 ; http://n2t.net/addgene:110324 ; RRID:Addgene_110324) -
For your References section:
Guanylate-binding protein-1 is a potential new therapeutic target for triple-negative breast cancer. Quintero M, Adamoski D, Reis LMD, Ascencao CFR, Oliveira KRS, Goncalves KA, Dias MM, Carazzolle MF, Dias SMG. BMC Cancer. 2017 Nov 7;17(1):727. doi: 10.1186/s12885-017-3726-2. 10.1186/s12885-017-3726-2 [pii] PubMed 29115931