-
PurposeMammalian expression of glutaminase isoform KGA (wild type) with V5 and 6xHis tags
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110332 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1D/V5-His-TOPO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5514
- Total vector size (bp) 7521
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKGA glutaminase
-
Alt nameGLS (KGA Isoform)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2007
-
GenBank ID2744 NM_014905
-
Entrez GeneGLS (a.k.a. AAD20, CASGID, DEE71, EIEE71, GAC, GAM, GDPAG, GLS1, KGA)
- Promoter CMV
-
Tags
/ Fusion Proteins
- V5 (C terminal on backbone)
- 6xHis (C terminal on backbone)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer CMV Forward 5' CGCAAATGGGCGGTAGGCGTG 3' (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDr. Richard Cerione
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1D V5-His-TOPO-KGA.wt was a gift from Sandra Martha Gomes Dias (Addgene plasmid # 110332 ; http://n2t.net/addgene:110332 ; RRID:Addgene_110332) -
For your References section:
Mitochondrial localization and structure-based phosphate activation mechanism of Glutaminase C with implications for cancer metabolism. Cassago A, Ferreira AP, Ferreira IM, Fornezari C, Gomes ER, Greene KS, Pereira HM, Garratt RC, Dias SM, Ambrosio AL. Proc Natl Acad Sci U S A. 2012 Jan 24;109(4):1092-7. doi: 10.1073/pnas.1112495109. Epub 2012 Jan 6. 10.1073/pnas.1112495109 PubMed 22228304