pQC V5 MCS IRES Puro
(Plasmid
#110342)
-
Purpose(Empty Backbone) γ-Retroviral transfer vector for cloning and expressing your gene of interest. V5 N-Terminal tag, IRES-driven Puromycin selection.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110342 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepQC MCS IRES Puro
-
Backbone manufacturer#110343
- Backbone size (bp) 7067
-
Modifications to backboneV5 tag were added over BamHI site (without destruction at 3') with annealed oligos (5' GATCACCATGGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGG 3' and 5' GATCCCGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCCATGGT 3')
-
Vector typeMammalian Expression, Retroviral
- Promoter CMV
-
Selectable markersPuromycin
-
Tag
/ Fusion Protein
- V5 (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer pQC Seq Fow 5'-ACGCCATCCACGCTGTTTTGACCT-3'
- 3′ sequencing primer pQC Seq Rev 5'-AAGCGGCTTCGGCCAGTAACGTTA-3' (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byUsed sequences from pQC mKorange IX (Addgene #37344), Dr. Connie Cepko and pLKO.1 - TRC cloning vector (Addgene #10878), Dr. David Root
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pQC-based γ-Retroviral transfer vector for cloning and expressing your gene of interest. IRES-driven Puromycin selection.
Also available as:
V5-mKO2-MCS-IRES-Puro (Addgene #110341)
V5 MCS IRES Puro (Addgene #110342)
MCS IRES Puro (Addgene #110343)
MCS IRES G418 (Addgene #110344)
V5 MCS IRES G418 (Addgene #110345)
All vectors can be used for TA-cloning (After XcmI cleavage), or BamHI-AgeI-PmeI-EcoRI restriction cloning.
Weinberg Lab recommends using pUMVC (Addgene #8449) and VSV-G (#8454) for packaging.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQC V5 MCS IRES Puro was a gift from Sandra Martha Gomes Dias (Addgene plasmid # 110342 ; http://n2t.net/addgene:110342 ; RRID:Addgene_110342)