Skip to main content

tet-pLKO.puro_shHuR CDS
(Plasmid #110411)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110411 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Tet-pLKO-puro
  • Backbone manufacturer
    #21915
  • Backbone size w/o insert (bp) 10633
  • Total vector size (bp) 8816
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ELAVL1 (HuR)
  • gRNA/shRNA sequence
    CGAGCTCAGAGGTGATCAAAG
  • Species
    H. sapiens (human)
  • Promoter H1/TO (RNA PolIII)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GACAGAGACAGATCCATTCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

See Addgene's pLKO family protocol http://www.addgene.org/plko on how to use the pLKO family vectors.

Plasmid grows more slowly than standard plasmids.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    tet-pLKO.puro_shHuR CDS was a gift from Sandra Martha Gomes Dias (Addgene plasmid # 110411 ; http://n2t.net/addgene:110411 ; RRID:Addgene_110411)