Skip to main content

pX330.puro sgRNA GLS Exon5
(Plasmid #110416)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110416 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pX330.puro
  • Backbone manufacturer
    #110403
  • Backbone size w/o insert (bp) 9906
  • Total vector size (bp) 9909
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GLS glutaminase
  • gRNA/shRNA sequence
    GCCAAATTCAGTCCCGATTTG
  • Species
    H. sapiens (human)
  • Entrez Gene
    GLS (a.k.a. AAD20, CASGID, DEE71, EIEE71, GAC, GAM, GDPAG, GLS1, KGA)
  • Promoter CBh

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer agggatggttggttggtggg
  • 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330.puro sgRNA GLS Exon5 was a gift from Sandra Martha Gomes Dias (Addgene plasmid # 110416)