Sandra Martha Gomes Dias Lab:
Dias lab diverse plasmid collection
Unpublished
Unpublished
Plasmids from Article
ID | Plasmid | Purpose |
---|---|---|
110417 | pcDNA3.1D V5-His-TOPO-HuR.wt | Mammalian expression of HuR (wild type) |
110419 | pLKO.1-blast shGFP | shGFP control, silence GFP gene, blasticidin selection. |
110420 | pLKO.1-blast shKGA | shKGA, silence glutaminase KGA isoform, blasticidin selection. |
110421 | tet-pLKO.puro_shGFP | shGFP control, silence GFP gene, doxycycline inducible, puromycin selection |
110422 | tet-pLKO.puro_shLuc | shLuc control, silence Luc gene, doxycycline inducible, puromycin selection |
110423 | tet-pLKO.puro_shGAC | shGAC, silence glutaminase GAC isoform, doxycycline inducible, puromycin selection |
110426 | pLKO.1-TRC.mKO2_shHuR CDS | TRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2. |