Sandra Martha Gomes Dias Lab: Dias lab diverse plasmid collection
Unpublished
Plasmids from Article
| ID | Plasmid | Purpose |
|---|---|---|
| 110417 | pcDNA3.1D V5-His-TOPO-HuR.wt | Mammalian expression of HuR (wild type) |
| 110419 | pLKO.1-blast shGFP | shGFP control, silence GFP gene, blasticidin selection. |
| 110420 | pLKO.1-blast shKGA | shKGA, silence glutaminase KGA isoform, blasticidin selection. |
| 110422 | tet-pLKO.puro_shLuc | shLuc control, silence Luc gene, doxycycline inducible, puromycin selection |
| 110423 | tet-pLKO.puro_shGAC | shGAC, silence glutaminase GAC isoform, doxycycline inducible, puromycin selection |
| 110426 | pLKO.1-TRC.mKO2_shHuR CDS | TRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2. |