Skip to main content

pJM260 (miniCTX1-rhaSR-PrhaBAD-stRBS-aacC1)
(Plasmid #110572)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110572 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    miniCTX1
  • Backbone manufacturer
    Herbert Schweizer
  • Backbone size w/o insert (bp) 5610
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    rhaSR-PrhaBAD-stRBS-aacC1
  • Promoter rhaSR-PrhaBAD

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer oJM730 (gatacagcgtgaattttcagg)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJM260 (miniCTX1-rhaSR-PrhaBAD-stRBS-aacC1) was a gift from Joanna Goldberg (Addgene plasmid # 110572 ; http://n2t.net/addgene:110572 ; RRID:Addgene_110572)
  • For your References section:

    The Escherichia coli rhaSR-PrhaBAD Inducible Promoter System Allows Tightly Controlled Gene Expression over a Wide Range in Pseudomonas aeruginosa. Meisner J, Goldberg JB. Appl Environ Microbiol. 2016 Oct 27;82(22):6715-6727. doi: 10.1128/AEM.02041-16. Print 2016 Nov 15. 10.1128/AEM.02041-16 PubMed 27613678