pJM260 (miniCTX1-rhaSR-PrhaBAD-stRBS-aacC1)
(Plasmid
#110572)
-
PurposeIntegration vector for Pseudomonas aeruginosa with rhaSR-PrhaBAD inducible promoter and StRBS-aacC1 insert
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110572 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneminiCTX1
-
Backbone manufacturerHerbert Schweizer
- Backbone size w/o insert (bp) 5610
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namerhaSR-PrhaBAD-stRBS-aacC1
- Promoter rhaSR-PrhaBAD
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer oJM730 (gatacagcgtgaattttcagg) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJM260 (miniCTX1-rhaSR-PrhaBAD-stRBS-aacC1) was a gift from Joanna Goldberg (Addgene plasmid # 110572 ; http://n2t.net/addgene:110572 ; RRID:Addgene_110572) -
For your References section:
The Escherichia coli rhaSR-PrhaBAD Inducible Promoter System Allows Tightly Controlled Gene Expression over a Wide Range in Pseudomonas aeruginosa. Meisner J, Goldberg JB. Appl Environ Microbiol. 2016 Oct 27;82(22):6715-6727. doi: 10.1128/AEM.02041-16. Print 2016 Nov 15. 10.1128/AEM.02041-16 PubMed 27613678