pJet-CMV-CD5cmyc2-bglpA
(Plasmid #110645)

• Purpose: Expression plasmid for c-Myc-tag embedded into human CD52 with short polyA
• Depositing Lab: Dmitriy Mazurov
• Publication: Zotova et al Sci Rep. 2019 Feb 28;9(1):3132. doi: 10.1038/s41598-019-40219-z.

Backbone

• Vector backbone: pJet 1.2
• Total vector size (bp): 4101
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CMV-CDcmyc2-bglpA
• Species: H. sapiens (human)
• Insert Size (bp): 1130
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xba I (not destroyed)
• 3′ cloning site: Kpn I (not destroyed)
• 5′ sequencing primer: AAGAACATCGATTTTCCATGGCAG
• 3′ sequencing primer: CGACTCACTATAGGGAGAGCGGC

Resource Information

• Supplemental Documents:
  • pJet-5cmyc2-pA49

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry