pJet-CMV-CD5cmyc2-bglpA
(Plasmid
#110645)
-
PurposeExpression plasmid for c-Myc-tag embedded into human CD52 with short polyA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110645 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJet 1.2
- Total vector size (bp) 4101
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCMV-CDcmyc2-bglpA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1130
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xba I (not destroyed)
- 3′ cloning site Kpn I (not destroyed)
- 5′ sequencing primer AAGAACATCGATTTTCCATGGCAG
- 3′ sequencing primer CGACTCACTATAGGGAGAGCGGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJet-CMV-CD5cmyc2-bglpA was a gift from Dmitriy Mazurov (Addgene plasmid # 110645 ; http://n2t.net/addgene:110645 ; RRID:Addgene_110645) -
For your References section:
Isolation of gene-edited cells via knock-in of short glycophosphatidylinositol-anchored epitope tags. Zotova A, Pichugin A, Atemasova A, Knyazhanskaya E, Lopatukhina E, Mitkin N, Holmuhamedov E, Gottikh M, Kuprash D, Filatov A, Mazurov D. Sci Rep. 2019 Feb 28;9(1):3132. doi: 10.1038/s41598-019-40219-z. 10.1038/s41598-019-40219-z PubMed 30816313