B. longum 16S toehold switch sensor
(Plasmid
#110699)
-
PurposeToehold switch sensor to detect the V3 hypervariable region of the 16S rRNA with GFP output
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110699 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCOLA
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameB. longum 16S toehold switch sensor
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ttcaccaccctgaattgactc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
B. longum 16S toehold switch sensor was a gift from James Collins (Addgene plasmid # 110699 ; http://n2t.net/addgene:110699 ; RRID:Addgene_110699) -
For your References section:
A low-cost paper-based synthetic biology platform for analyzing gut microbiota and host biomarkers. Takahashi MK, Tan X, Dy AJ, Braff D, Akana RT, Furuta Y, Donghia N, Ananthakrishnan A, Collins JJ. Nat Commun. 2018 Aug 21;9(1):3347. doi: 10.1038/s41467-018-05864-4. 10.1038/s41467-018-05864-4 PubMed 30131493