Skip to main content

proISG15 (2-165)
(Plasmid #110762)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110762 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28a
  • Backbone manufacturer
    Merck
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ISG15
  • Species
    H. sapiens (human)
  • Entrez Gene
    ISG15 (a.k.a. G1P2, IFI15, IMD38, IP17, UCRP, hUCRP)
  • Promoter T7
  • Tag / Fusion Protein
    • N-His6-3C (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GGGTTATGCTAGTTATTGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    ISG15 gene obtained through gene synthesis
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    proISG15 (2-165) was a gift from David Komander (Addgene plasmid # 110762 ; http://n2t.net/addgene:110762 ; RRID:Addgene_110762)
  • For your References section:

    Irreversible inactivation of ISG15 by a viral leader protease enables alternative infection detection strategies. Swatek KN, Aumayr M, Pruneda JN, Visser LJ, Berryman S, Kueck AF, Geurink PP, Ovaa H, van Kuppeveld FJM, Tuthill TJ, Skern T, Komander D. Proc Natl Acad Sci U S A. 2018 Mar 6;115(10):2371-2376. doi: 10.1073/pnas.1710617115. Epub 2018 Feb 20. 10.1073/pnas.1710617115 PubMed 29463763