px330 Gatad2a sgRNA (for deletion)
(Plasmid
#110814)
-
PurposeExpressed sgRNA for generating Gatad2a deletion (knockout ) in mouse cell lines
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110814 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepx330
-
Backbone manufacturerFeng Zhang
- Backbone size w/o insert (bp) 8500
- Total vector size (bp) 8520
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemGataD2a
-
Alt namep66a
-
gRNA/shRNA sequenceGAGCACAATCACATCAGGCG
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)20
-
Entrez GeneGatad2a (a.k.a. 1110066C11Rik)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer TGGCCTTTTGCTCACATGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px330 Gatad2a sgRNA (for deletion) was a gift from Jacob Hanna (Addgene plasmid # 110814 ; http://n2t.net/addgene:110814 ; RRID:Addgene_110814) -
For your References section:
Neutralizing Gatad2a-Chd4-Mbd3/NuRD Complex Facilitates Deterministic Induction of Naive Pluripotency. Mor N, Rais Y, Sheban D, Peles S, Aguilera-Castrejon A, Zviran A, Elinger D, Viukov S, Geula S, Krupalnik V, Zerbib M, Chomsky E, Lasman L, Shani T, Bayerl J, Gafni O, Hanna S, Buenrostro JD, Hagai T, Masika H, Vainorius G, Bergman Y, Greenleaf WJ, Esteban MA, Elling U, Levin Y, Massarwa R, Merbl Y, Novershtern N, Hanna JH. Cell Stem Cell. 2018 Sep 6;23(3):412-425.e10. doi: 10.1016/j.stem.2018.07.004. Epub 2018 Aug 16. 10.1016/j.stem.2018.07.004 PubMed 30122475