pRP(Exp)-CMV> ORF_924bp (Azgp1):dTomato:IRES:Puro
(Plasmid
#110831)
-
PurposeExpresses both zinc alpha-2 glycoprotein (ZAG) and dTomato (dT) reporter, where the fluorescent dT reporter is fused with the ZAG protein.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110831 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
-
Backbone manufacturervector builder
- Backbone size w/o insert (bp) 5668
- Total vector size (bp) 6592
-
Vector typenon-viral gene expression vector
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAzgp1
-
Alt nameZAG-dT
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)924
-
Entrez GeneAzgp1 (a.k.a. Zag)
- Promoter CMV
-
Tag
/ Fusion Protein
- dTomato (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ORF_924bp (Azgp1)-reverse primer: CTGAGGCTGAGCTACAACATTG
- 3′ sequencing primer CMV-forward primer: TTGACGCAAATGGGCGGTAGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byvector builder
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRP(Exp)-CMV> ORF_924bp (Azgp1):dTomato:IRES:Puro was a gift from Ande Satyanarayana (Addgene plasmid # 110831 ; http://n2t.net/addgene:110831 ; RRID:Addgene_110831) -
For your References section:
The tumor secretory factor ZAG promotes white adipose tissue browning and energy wasting. Elattar S, Dimri M, Satyanarayana A. FASEB J. 2018 Mar 23:fj201701465RR. doi: 10.1096/fj.201701465RR. 10.1096/fj.201701465RR PubMed 29570397