Skip to main content

pLenti-VQR-P2A-GFP-PGK-Puro
(Plasmid #110861)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110861 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Adapted from lentiCRISPRv1
  • Backbone size w/o insert (bp) 6296
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin ; GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Cas9-VQR
  • Alt name
    VQR
  • Species
    Synthetic
  • Insert Size (bp)
    4212
  • Mutation
    D1135V, R1335Q, T1337R
  • Promoter EF1s
  • Tag / Fusion Protein
    • 3X FLAG (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAAGTGCAGTAGTCGCCGTG
  • 3′ sequencing primer TTAAGAATACCAGTCAATCTTTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-VQR-P2A-GFP-PGK-Puro was a gift from Lukas Dow (Addgene plasmid # 110861 ; http://n2t.net/addgene:110861 ; RRID:Addgene_110861)
  • For your References section:

    Optimized base editors enable efficient editing in cells, organoids and mice. Zafra MP, Schatoff EM, Katti A, Foronda M, Breinig M, Schweitzer AY, Simon A, Han T, Goswami S, Montgomery E, Thibado J, Kastenhuber ER, Sanchez-Rivera FJ, Shi J, Vakoc CR, Lowe SW, Tschaharganeh DF, Dow LE. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194. 10.1038/nbt.4194 PubMed 29969439