Skip to main content

pCZGY553
(Plasmid #110883)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110883 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Gateway Destination Vector
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5020
  • Total vector size (bp) 6135
  • Vector type
    Gateway Destination Vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Pmec-4
  • Alt name
    mec-4 promoter
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    1025

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CAGGAAACAGCTATGACCATG
  • 3′ sequencing primer AAACTTGTGATGTACCGTCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCZGY553 was a gift from Andrew Chisholm (Addgene plasmid # 110883 ; http://n2t.net/addgene:110883 ; RRID:Addgene_110883)
  • For your References section:

    Calcium and cyclic AMP promote axonal regeneration in Caenorhabditis elegans and require DLK-1 kinase. Ghosh-Roy A, Wu Z, Goncharov A, Jin Y, Chisholm AD. J Neurosci. 2010 Mar 3;30(9):3175-83. doi: 10.1523/JNEUROSCI.5464-09.2010. 10.1523/JNEUROSCI.5464-09.2010 PubMed 20203177