pCZGY553
(Plasmid
#110883)
-
PurposePmec-4 Gateway Destination vector for cloning for expression in C. elegans mechanosensory neurons
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110883 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneGateway Destination Vector
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5020
- Total vector size (bp) 6135
-
Vector typeGateway Destination Vector
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePmec-4
-
Alt namemec-4 promoter
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)1025
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CAGGAAACAGCTATGACCATG
- 3′ sequencing primer AAACTTGTGATGTACCGTCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCZGY553 was a gift from Andrew Chisholm (Addgene plasmid # 110883 ; http://n2t.net/addgene:110883 ; RRID:Addgene_110883) -
For your References section:
Calcium and cyclic AMP promote axonal regeneration in Caenorhabditis elegans and require DLK-1 kinase. Ghosh-Roy A, Wu Z, Goncharov A, Jin Y, Chisholm AD. J Neurosci. 2010 Mar 3;30(9):3175-83. doi: 10.1523/JNEUROSCI.5464-09.2010. 10.1523/JNEUROSCI.5464-09.2010 PubMed 20203177