-
Purposedrives mCherry in C. elegans intestinal cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59784 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCFJ150
- Total vector size (bp) 8283
-
Modifications to backbonemodified to include PmeI restriction digest site for Gibson cloning inserts
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameelt-2 promoter
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)5002
-
Entrez Geneelt-2 (a.k.a. CELE_C33D3.1)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ggtcgagctgaatacacgtgc
- 3′ sequencing primer TCTATAATCTATTTTCTAGTTTCTATTTTATTAGAATGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCherry (worm)
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)864
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer ATGGTCTCAAAGGGTGAAGAAG
- 3′ sequencing primer CTACTTATACAATTCATCCATGCCAC (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameunc-54 3' UTR
-
Insert Size (bp)705
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer gtccaattactcttcaacatccc
- 3′ sequencing primer AAACAGTTATGTTTGGTATATTGGGAATG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSA110 was a gift from Jeremy Nance (Addgene plasmid # 59784 ; http://n2t.net/addgene:59784 ; RRID:Addgene_59784) -
For your References section:
Repurposing an endogenous degradation system for rapid and targeted depletion of C. elegans proteins. Armenti ST, Lohmer LL, Sherwood DR, Nance J. Development. 2014 Dec;141(23):4640-7. doi: 10.1242/dev.115048. Epub 2014 Nov 5. 10.1242/dev.115048 PubMed 25377555