Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLenti-smURFP
(Plasmid #80349)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 80349 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLenti
  • Backbone manufacturer
    Deisseroth / Boyden lab
  • Backbone size w/o insert (bp) 8614
  • Total vector size (bp) 9016
  • Modifications to backbone
    Lentiviral transfer vector (2nd Generation) under CMV promoter
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Any growth strain that avoids recombination and 30 ˚C is recommended to avoid loss of DNA upon propagation.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    smURFP
  • Alt name
    small Ultra-Red Fluorescent Protein
  • Species
    Synthetic
  • Insert Size (bp)
    402
  • GenBank ID
    KX449134
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer taatacgactcactataggg
  • 3′ sequencing primer Unnecessary
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-smURFP was a gift from Erik Rodriguez & Roger Tsien (Addgene plasmid # 80349 ; http://n2t.net/addgene:80349 ; RRID:Addgene_80349)
  • For your References section:

    A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein. Rodriguez EA, Tran GN, Gross LA, Crisp JL, Shu X, Lin JY, Tsien RY. Nat Methods. 2016 Aug 1. doi: 10.1038/nmeth.3935. 10.1038/nmeth.3935 PubMed 27479328