Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pcDNA3-smURFP-IRES-HO-1
(Plasmid #80345)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 80345 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Thermo Fisher
  • Backbone size w/o insert (bp) 6842
  • Total vector size (bp) 7712
  • Modifications to backbone
    Contains Internal Ribosomal Entry Site (IRES) for expression of both smURFP and HO-I.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    smURFP
  • Alt name
    small Ultra-Red Fluorescent Protein
  • Species
    Synthetic
  • Insert Size (bp)
    402
  • Promoter CMV

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer Unnecessary
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    HO-1
  • Alt name
    Heme Oxygenase-1
  • Species
    Synechocystis
  • Insert Size (bp)
    723
  • Promoter IRES

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsiWI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer gtggctgcttatggtgacaatc
  • 3′ sequencing primer CCTCGACTGTGCCTTCTA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    All constructs with HO-1 was initially obtained from Professor J. Clark Lagarias (University of California, Davis).
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-smURFP-IRES-HO-1 was a gift from Erik Rodriguez & Roger Tsien (Addgene plasmid # 80345 ; http://n2t.net/addgene:80345 ; RRID:Addgene_80345)
  • For your References section:

    A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein. Rodriguez EA, Tran GN, Gross LA, Crisp JL, Shu X, Lin JY, Tsien RY. Nat Methods. 2016 Aug 1. doi: 10.1038/nmeth.3935. 10.1038/nmeth.3935 PubMed 27479328