Skip to main content

plko-puromycin-shTRX1-259
(Plasmid #110921)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110921 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO (puromycin)
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TRX1
  • gRNA/shRNA sequence
    GCTTCAGAGTGTGAAGTCAAA
  • Species
    H. sapiens (human)
  • Entrez Gene
    TXN (a.k.a. TRDX, TRX, TRX1, TXN1, Trx80)
  • Promoter unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer unknown
  • 3′ sequencing primer unknown
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The Rai lab uses XL-10 gold ultracompetent cells as the growth strain, but DH5alpha should work fine too.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    plko-puromycin-shTRX1-259 was a gift from Priyamvada Rai (Addgene plasmid # 110921 ; http://n2t.net/addgene:110921 ; RRID:Addgene_110921)
  • For your References section:

    Suppression of thioredoxin-1 induces premature senescence in normal human fibroblasts. Young JJ, Patel A, Rai P. Biochem Biophys Res Commun. 2010 Feb 12;392(3):363-8. doi: 10.1016/j.bbrc.2010.01.026. Epub 2010 Jan 13. 10.1016/j.bbrc.2010.01.026 PubMed 20074557