plko-tet-on-puromycin-shTRX1-259
(Plasmid
#110920)
-
PurposeTo knockdown Thioredoxin-1 following doxycycline addition
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110920 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO-Tet-on (puromycin)
-
Backbone manufacturerPUBMED ID: 19177017
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTRX1
-
gRNA/shRNA sequenceGCTTCAGAGTGTGAAGTCAAA
-
SpeciesH. sapiens (human)
-
Entrez GeneTXN (a.k.a. TRDX, TRX, TRX1, TXN1, Trx80)
- Promoter unknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer unknown
- 3′ sequencing primer unknown (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The Rai lab uses XL-10 gold ultracompetent cells as the growth strain, but DH5alpha should work fine too
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
plko-tet-on-puromycin-shTRX1-259 was a gift from Priyamvada Rai (Addgene plasmid # 110920 ; http://n2t.net/addgene:110920 ; RRID:Addgene_110920) -
For your References section:
Thioredoxin-1 protects against androgen receptor-induced redox vulnerability in castration-resistant prostate cancer. Samaranayake GJ, Troccoli CI, Huynh M, Lyles RDZ, Kage K, Win A, Lakshmanan V, Kwon D, Ban Y, Chen SX, Zarco ER, Jorda M, Burnstein KL, Rai P. Nat Commun. 2017 Oct 31;8(1):1204. doi: 10.1038/s41467-017-01269-x. 10.1038/s41467-017-01269-x [pii] PubMed 29089489