-
PurposeTet inducible scrambled shRNA.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 47541 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneTet-pLKO-puro
- Backbone size w/o insert (bp) 10633
- Total vector size (bp) 8775
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameScrambled shRNA
-
gRNA/shRNA sequenceCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG
-
SpeciesSynthetic
- Promoter H1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer H1 (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tet-pLKO-puro-Scrambled was a gift from Charles Rudin (Addgene plasmid # 47541 ; http://n2t.net/addgene:47541 ; RRID:Addgene_47541) -
For your References section:
Comprehensive genomic analysis identifies SOX2 as a frequently amplified gene in small-cell lung cancer. Rudin CM, Durinck S, Stawiski EW, Poirier JT, Modrusan Z, Shames DS, Bergbower EA, Guan Y, Shin J, Guillory J, Rivers CS, Foo CK, Bhatt D, Stinson J, Gnad F, Haverty PM, Gentleman R, Chaudhuri S, Janakiraman V, Jaiswal BS, Parikh C, Yuan W, Zhang Z, Koeppen H, Wu TD, Stern HM, Yauch RL, Huffman KE, Paskulin DD, Illei PB, Varella-Garcia M, Gazdar AF, de Sauvage FJ, Bourgon R, Minna JD, Brock MV, Seshagiri S. Nat Genet. 2012 Oct;44(10):1111-6. doi: 10.1038/ng.2405. Epub 2012 Sep 2. 10.1038/ng.2405 PubMed 22941189