Skip to main content
Addgene
Open Menu

GFP-TXNIP
(Plasmid #18758)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 18758 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 18758-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 18758-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH5 alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    thioredoxin-interacting protein
  • Alt name
    Txnip
  • Alt name
    VDUP-1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1193
  • Entrez Gene
    Txnip (a.k.a. 1200008J08Rik, Hyplip1, THIF, Tbp-2, VDUP1)
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site Sal I (unknown if destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-TXNIP was a gift from Clark Distelhorst (Addgene plasmid # 18758 ; http://n2t.net/addgene:18758 ; RRID:Addgene_18758)

  • For your References section:

    Thioredoxin-interacting protein (txnip) is a glucocorticoid-regulated primary response gene involved in mediating glucocorticoid-induced apoptosis. Wang Z, Rong YP, Malone MH, Davis MC, Zhong F, Distelhorst CW. Oncogene. 2006 Mar 23. 25(13):1903-13. 10.1038/sj.onc.1209218 PubMed 16301999
Related items:
Commonly requested with: