Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

GFP-TXNIP
(Plasmid #18758)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 18758 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH5 alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    thioredoxin-interacting protein
  • Alt name
    Txnip
  • Alt name
    VDUP-1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1193
  • Entrez Gene
    Txnip (a.k.a. 1200008J08Rik, Hyplip1, THIF, Tbp-2, VDUP1)
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site Sal I (unknown if destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-TXNIP was a gift from Clark Distelhorst (Addgene plasmid # 18758 ; http://n2t.net/addgene:18758 ; RRID:Addgene_18758)
  • For your References section:

    Thioredoxin-interacting protein (txnip) is a glucocorticoid-regulated primary response gene involved in mediating glucocorticoid-induced apoptosis. Wang Z, Rong YP, Malone MH, Davis MC, Zhong F, Distelhorst CW. Oncogene. 2006 Mar 23. 25(13):1903-13. 10.1038/sj.onc.1209218 PubMed 16301999