Skip to main content

pCT310
(Plasmid #111140)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 111140 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET302/NT-His
  • Backbone manufacturer
    Thermo Fisher (Invitrogen)
  • Backbone size w/o insert (bp) 5712
  • Total vector size (bp) 9949
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    dCas9
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    4101
  • Mutation
    D10A - H840A
  • Promoter T7
  • Tags / Fusion Proteins
    • 6X His (N terminal on insert)
    • 3X Flag (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer 5'_pET / CGATCCCGCGAAATTAATACGA
  • 3′ sequencing primer pFN Flexi REVseq / CTTTCGGGCTTTGTTAGCAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Frank Xie, Tjian Lab - Introduced D10A and H840A mutations to wild type SpCas9 (gift of the Doudna Lab)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCT310 was a gift from Robert Tjian (Addgene plasmid # 111140 ; http://n2t.net/addgene:111140 ; RRID:Addgene_111140)
  • For your References section:

    dCas9-targeted locus-specific protein isolation method identifies histone gene regulators. Tsui C, Inouye C, Levy M, Lu A, Florens L, Washburn MP, Tjian R. Proc Natl Acad Sci U S A. 2018 Mar 20;115(12):E2734-E2741. doi: 10.1073/pnas.1718844115. Epub 2018 Mar 5. 10.1073/pnas.1718844115 PubMed 29507191