-
PurposeBacterial expression of 6His-dCas9-3XFlag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 111140 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET302/NT-His
-
Backbone manufacturerThermo Fisher (Invitrogen)
- Backbone size w/o insert (bp) 5712
- Total vector size (bp) 9949
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namedCas9
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4101
-
MutationD10A - H840A
- Promoter T7
-
Tags
/ Fusion Proteins
- 6X His (N terminal on insert)
- 3X Flag (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer 5'_pET / CGATCCCGCGAAATTAATACGA
- 3′ sequencing primer pFN Flexi REVseq / CTTTCGGGCTTTGTTAGCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byFrank Xie, Tjian Lab - Introduced D10A and H840A mutations to wild type SpCas9 (gift of the Doudna Lab)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCT310 was a gift from Robert Tjian (Addgene plasmid # 111140 ; http://n2t.net/addgene:111140 ; RRID:Addgene_111140) -
For your References section:
dCas9-targeted locus-specific protein isolation method identifies histone gene regulators. Tsui C, Inouye C, Levy M, Lu A, Florens L, Washburn MP, Tjian R. Proc Natl Acad Sci U S A. 2018 Mar 20;115(12):E2734-E2741. doi: 10.1073/pnas.1718844115. Epub 2018 Mar 5. 10.1073/pnas.1718844115 PubMed 29507191