Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #111140)


Item Catalog # Description Quantity Price (USD)
Plasmid 111140 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Thermo Fisher (Invitrogen)
  • Backbone size w/o insert (bp) 5712
  • Total vector size (bp) 9949
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
  • Mutation
    D10A - H840A
  • Promoter T7
  • Tags / Fusion Proteins
    • 6X His (N terminal on insert)
    • 3X Flag (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer 5'_pET / CGATCCCGCGAAATTAATACGA
  • 3′ sequencing primer pFN Flexi REVseq / CTTTCGGGCTTTGTTAGCAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Frank Xie, Tjian Lab - Introduced D10A and H840A mutations to wild type SpCas9 (gift of the Doudna Lab)
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCT310 was a gift from Robert Tjian (Addgene plasmid # 111140 ; ; RRID:Addgene_111140)
  • For your References section:

    dCas9-targeted locus-specific protein isolation method identifies histone gene regulators. Tsui C, Inouye C, Levy M, Lu A, Florens L, Washburn MP, Tjian R. Proc Natl Acad Sci U S A. 2018 Mar 20;115(12):E2734-E2741. doi: 10.1073/pnas.1718844115. Epub 2018 Mar 5. 10.1073/pnas.1718844115 PubMed 29507191