pPICZc-HsACTG1*-thymosinB-8His
(Plasmid
#111147)
-
PurposeExpresses human gamma-actin (codon is optimised for expression in Pichia pastoris) fused with thymosin beta and a His tag.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 111147 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPICZc
-
Backbone manufacturerInvitrogen
-
Vector typeYeast Expression ; Pichia pastoris integration vector
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsUse LB low salt
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameactin gamma 1
-
Alt nameNon-muscle gamma-actin
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1125
-
Mutationcodon-optimised for expression in Pichia pastoris
-
Entrez GeneACTG1 (a.k.a. ACT, ACTG, DFNA20, DFNA26, HEL-176)
- Promoter AOX1
-
Tag
/ Fusion Protein
- Thymosin beta and a His-tag (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer GACTGGTTCCAATTGACAAGC
- 3′ sequencing primer GCAAATGGCATTCTGACATCC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPICZc-HsACTG1*-thymosinB-8His was a gift from Mohan Balasubramanian (Addgene plasmid # 111147 ; http://n2t.net/addgene:111147 ; RRID:Addgene_111147) -
For your References section:
Rapid production of pure recombinant actin isoforms in Pichia pastoris. Hatano T, Alioto S, Roscioli E, Palani S, Clarke ST, Kamnev A, Hernandez-Fernaud JR, Sivashanmugam L, Chapa-Y-Lazo B, Jones AME, Robinson RC, Sampath K, Mishima M, McAinsh AD, Goode BL, Balasubramanian MK. J Cell Sci. 2018 Mar 13. pii: jcs.213827. doi: 10.1242/jcs.213827. 10.1242/jcs.213827 PubMed 29535210