Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #111147)


Item Catalog # Description Quantity Price (USD)
Plasmid 111147 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Vector type
    Yeast Expression ; Pichia pastoris integration vector
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Use LB low salt
  • Copy number
    High Copy


  • Gene/Insert name
    actin gamma 1
  • Alt name
    Non-muscle gamma-actin
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    codon-optimised for expression in Pichia pastoris
  • Entrez Gene
    ACTG1 (a.k.a. ACT, ACTG, DFNA20, DFNA26, HEL-176)
  • Promoter AOX1
  • Tag / Fusion Protein
    • Thymosin beta and a His-tag (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer GACTGGTTCCAATTGACAAGC
  • 3′ sequencing primer GCAAATGGCATTCTGACATCC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPICZc-HsACTG1*-thymosinB-8His was a gift from Mohan Balasubramanian (Addgene plasmid # 111147 ; ; RRID:Addgene_111147)
  • For your References section:

    Rapid production of pure recombinant actin isoforms in Pichia pastoris. Hatano T, Alioto S, Roscioli E, Palani S, Clarke ST, Kamnev A, Hernandez-Fernaud JR, Sivashanmugam L, Chapa-Y-Lazo B, Jones AME, Robinson RC, Sampath K, Mishima M, McAinsh AD, Goode BL, Balasubramanian MK. J Cell Sci. 2018 Mar 13. pii: jcs.213827. doi: 10.1242/jcs.213827. 10.1242/jcs.213827 PubMed 29535210