Skip to main content

MsMUT_sgRNA3
(Plasmid #111297)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 111297 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    sgRNA3 against murine MUT
  • gRNA/shRNA sequence
    TAAGTGACCACCCCGATGTC

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MsMUT_sgRNA3 was a gift from Vamsi Mootha (Addgene plasmid # 111297 ; http://n2t.net/addgene:111297 ; RRID:Addgene_111297)
  • For your References section:

    The Human Knockout Gene CLYBL Connects Itaconate to Vitamin B12. Shen H, Campanello GC, Flicker D, Grabarek Z, Hu J, Luo C, Banerjee R, Mootha VK. Cell. 2017 Nov 2;171(4):771-782.e11. doi: 10.1016/j.cell.2017.09.051. Epub 2017 Oct 19. 10.1016/j.cell.2017.09.051 PubMed 29056341