- 
            Purpose(Empty Backbone) Phagemid for producing DNA origami scaffolds, derived from pUC18 and M13mp18
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 111401 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepScaf
 - Backbone size (bp) 3154
 - 
              Modifications to backboneM13 plus-strand origin, M13 packaging sequence (PS), M13 plus-strand terminator.
 - 
              Vector typeBacterial Expression
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
              Growth instructions37°C for plasmid growth, 30°C for phagemid ssDNA preparation (if transformed into HFR/F+/F' strain)
 - 
            Copy numberHigh Copy
 
Cloning Information
- Cloning method Restriction Enzyme
 - 5′ sequencing primer TAAGGGATTTTGCCGATTTC
 - 3′ sequencing primer CACAGGAAACAGCTATGACCATGATT (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 - 
            Article Citing this Plasmid
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
Depositor Comments
Preprint available at https://www.biorxiv.org/content/early/2018/04/27/309682
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pScaf was a gift from Shawn Douglas (Addgene plasmid # 111401 ; http://n2t.net/addgene:111401 ; RRID:Addgene_111401) - 
                
For your References section:
Construction of a novel phagemid to produce custom DNA origami scaffolds. Nafisi PM, Aksel T, Douglas SM. Synth Biol (Oxf). 2018 Jan;3(1). doi: 10.1093/synbio/ysy015. Epub 2018 Aug 9. 10.1093/synbio/ysy015 PubMed 30984875