Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pACEBac1-PARP2-Flag-His-WT
(Plasmid #111574)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 111574 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pACEBac1
  • Modifications to backbone
    C-terminal Flag-6xHis
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PARP2
  • Alt name
    Poly(ADP-ribose) polymerase 2
  • Alt name
    ARTD2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1749
  • Entrez Gene
    PARP2 (a.k.a. ADPRT2, ADPRTL2, ADPRTL3, ARTD2, PARP-2, pADPRT-2)
  • Promoter polyhedrin promoter
  • Tags / Fusion Proteins
    • C-terminal 6xHis (C terminal on backbone)
    • C-terminal Flag (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer Custom (gtatcgattcgcgacctactcc)
  • 3′ sequencing primer SV40pA-R
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pACEBac1-PARP2-Flag-His-WT was a gift from Thomas Muir (Addgene plasmid # 111574 ; http://n2t.net/addgene:111574 ; RRID:Addgene_111574)
  • For your References section:

    Acetylation blocks DNA damage-induced chromatin ADP-ribosylation. Liszczak G, Diehl KL, Dann GP, Muir TW. Nat Chem Biol. 2018 Jul 16. pii: 10.1038/s41589-018-0097-1. doi: 10.1038/s41589-018-0097-1. 10.1038/s41589-018-0097-1 PubMed 30013063