Skip to main content
Addgene

pmCherry-N1-EXO1b-D173A
(Plasmid #111622)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 111622 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pmCherry-N1
  • Modifications to backbone
    eGFP of peGFP-N1 plasmid was substituted with mCherry
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Exonuclease 1b D173A
  • Alt name
    EXO1-D173A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2538
  • Entrez Gene
    EXO1 (a.k.a. HEX1, hExoI)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer ACCAGAGTCGGGTACTGTTTCAGA
  • 3′ sequencing primer TAGTGTTCCCAAAGTGGGTGGTGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pmCherry-N1-EXO1b-D173A presents K589, H354, E670, R723C polymorphisms, normally expressed in different type of cells analysed

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmCherry-N1-EXO1b-D173A was a gift from Marco Muzi-Falconi (Addgene plasmid # 111622 ; http://n2t.net/addgene:111622 ; RRID:Addgene_111622)
  • For your References section:

    Coordinated Activity of Y Family TLS Polymerases and EXO1 Protects Non-S Phase Cells from UV-Induced Cytotoxic Lesions. Sertic S, Mollica A, Campus I, Roma S, Tumini E, Aguilera A, Muzi-Falconi M. Mol Cell. 2018 Apr 5;70(1):34-47.e4. doi: 10.1016/j.molcel.2018.02.017. Epub 2018 Mar 15. 10.1016/j.molcel.2018.02.017 PubMed 29551515