pMSCV_puro_41585
(Plasmid
#111631)
-
PurposeComplementation of Dicer_KO mESCs with mutated human DICER isoform
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 111631 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMSCV-puro
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6264
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFLAG-hsDicer (D1320A/D1709A)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5808
-
MutationD1320A/D1709A
-
Entrez GeneDICER1 (a.k.a. DCR1, Dicer, Dicer1e, GLOW, HERNA, K12H4.8-LIKE, MNG1, RMSE2, aviD)
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer 5' aattagatctctcgagatggactacaa agacgatgacg 3'
- 3′ sequencing primer 5' attcgttaacctcgagtcagctattgggaa cctgag 3' (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFLAG-hsDicer (D1320A/D1709A) from addgene plasmid #41585
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cloning performed in 2 steps: 1) PCR amplification of the original plasmid using primers featuring an overhang containing an XhoI restriction site, 2) Digestion of the pMSCV puro plamid by XhoI and ligation of the insert
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV_puro_41585 was a gift from Constance Ciaudo (Addgene plasmid # 111631 ; http://n2t.net/addgene:111631 ; RRID:Addgene_111631)