Skip to main content

pMSCV_puro_41589
(Plasmid #111632)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 111632 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMSCV-puro
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6264
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FLAG-hsDicer (K70A)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    5808
  • Mutation
    K70A
  • Entrez Gene
    DICER1 (a.k.a. DCR1, Dicer, Dicer1e, GLOW, HERNA, K12H4.8-LIKE, MNG1, RMSE2, aviD)
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer 5' aattagatctctcgagatggactacaa agacgatgacg 3'
  • 3′ sequencing primer 5' attcgttaacctcgagtcagctattgggaa cctgag 3'
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    FLAG-hsDicer (K70A) from addgene plasmid #41589

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Cloning performed in 2 steps: 1) PCR amplification of the original plasmid using primers featuring an overhang containing an XhoI restriction site, 2) Digestion of the pMSCV puro plamid by XhoI and ligation of the insert

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCV_puro_41589 was a gift from Constance Ciaudo (Addgene plasmid # 111632 ; http://n2t.net/addgene:111632 ; RRID:Addgene_111632)