pxCas9CR4
(Plasmid
#111656)
-
PurposePCas9CR4 with the xCas9 mutations allowing NG PAM sites
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 111656 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep15A origin
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTetR and xCas9
-
SpeciesSynthetic; E. coli
-
MutationxCas9 mutations
-
Tag
/ Fusion Protein
- ssrA (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer cgtctcattttcgccagatatc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bypdCas9 plasmid from Stanley Qi at UCSF and pCas9CR4 from Kristala Prather at MIT
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pxCas9CR4 was a gift from Christopher Reisch (Addgene plasmid # 111656 ; http://n2t.net/addgene:111656 ; RRID:Addgene_111656)