CAG-SaCas9-WPRE
(Plasmid
#89996)
-
PurposeExpresses high levels of WT SaCas9 for genome editing
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89996 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAG
- Total vector size (bp) 8876
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSaCas9
-
SpeciesStaphylococcus aureus
-
Entrez GeneNEWENTRY
- Promoter CAG
-
Tags
/ Fusion Proteins
- SV40 NLS (N terminal on insert)
- Nucleoplasmin NLS (C terminal on insert)
- 3xHA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer pCAG-F GCAACGTGCTGGTTATTGTG
- 3′ sequencing primer M13 Reverse CAGGAAACAGCTATGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySaCas9 was cloned from pX601 plasmid (a gift from Feng Zhang, Addgene plasmid # 61591)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAG-SaCas9-WPRE was a gift from Timo Otonkoski (Addgene plasmid # 89996 ; http://n2t.net/addgene:89996 ; RRID:Addgene_89996) -
For your References section:
Generation of a SOX2 reporter human induced pluripotent stem cell line using CRISPR/SaCas9. Balboa D, Weltner J, Novik Y, Eurola S, Wartiovaara K, Otonkoski T. Stem Cell Res. 2017 Jul;22:16-19. doi: 10.1016/j.scr.2017.05.005. Epub 2017 May 17. 10.1016/j.scr.2017.05.005 PubMed 28952927